View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12580_low_54 (Length: 224)
Name: NF12580_low_54
Description: NF12580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12580_low_54 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 6 - 224
Target Start/End: Original strand, 16342724 - 16342946
Alignment:
| Q |
6 |
aaattgatcatataatatctcaatcgtactt-gtttgtttttaaaaatattatacgttannnnnnnnnnnn--cgaagtatgtatttccttcttccacaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
16342724 |
aaattgatcatataatatctcaatcgtactttgtttgtttttaaaaatattatacgctgtcttattttcttttcgaagtatgtatttccttcttccacaa |
16342823 |
T |
 |
| Q |
103 |
aactctactcacaaataaagtttgaagaaaatccagtcacgtgcgtgcgtaatctttctgtaattcattttttacaggaaaa-aataataattcatagta |
201 |
Q |
| |
|
||||||||||||||| |||||||| |||||||| ||||||||||||| |||||||||||||||||||||||| | ||||||| ||||||||||||||||| |
|
|
| T |
16342824 |
aactctactcacaaacaaagtttgtagaaaatcgagtcacgtgcgtgagtaatctttctgtaattcatttttgaaaggaaaataataataattcatagta |
16342923 |
T |
 |
| Q |
202 |
taaaaataacaagagaaaatcaa |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
16342924 |
taaaaataacaagagaaaatcaa |
16342946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University