View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12581_high_4 (Length: 360)
Name: NF12581_high_4
Description: NF12581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12581_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 5e-50; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 18 - 134
Target Start/End: Complemental strand, 1323023 - 1322907
Alignment:
| Q |
18 |
catcataggatgtaatttgcatttggagagcaaaattatgttaagcaaaatttttctcttttattgatacttatctaattttaataatgatgtcatgtct |
117 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1323023 |
catcataaggtgtaatttgcatttggagagcaaaattatgttaagcaaattttttctcttttattgatacttatctaattttaataatgatgtcatgttt |
1322924 |
T |
 |
| Q |
118 |
tagattttctattgaaa |
134 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1322923 |
tagattttctattgaaa |
1322907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 198 - 287
Target Start/End: Complemental strand, 1322843 - 1322755
Alignment:
| Q |
198 |
agatagcttttggtgtatcatgagattgtagtttgnnnnnnnnnttgatgtagagatgcgtgtaccaggttctcattgaacgtctgattc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1322843 |
agatagcttttggtgtatcatgagattgtagtttgaaattttt-ttgatgtagagatgcgtgtaccaggttctcgttgaacgtctgattc |
1322755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 305 - 340
Target Start/End: Complemental strand, 1322768 - 1322733
Alignment:
| Q |
305 |
tgaacgtctgattcatgatgagttagactttacatg |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1322768 |
tgaacgtctgattcatgatgtgttagactttacatg |
1322733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University