View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12581_high_6 (Length: 288)
Name: NF12581_high_6
Description: NF12581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12581_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 53 - 280
Target Start/End: Complemental strand, 6190130 - 6189906
Alignment:
| Q |
53 |
ctgggtgagcatgtgacctgatgacttccccttcttcaattattatcgttacatgttcttttattgtgtcctattgaccacatctcttagatttgactgt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6190130 |
ctgggtgagcatgtgacctgatgacttccccttc---aattattatcgttacatgttcttttattgtgtcctattgaccacatctcttagatttgactgt |
6190034 |
T |
 |
| Q |
153 |
acctaaaatcgtcttcaatcttgtaggatttgttggttctttcagaacagtgtttactcctcttagtaatagaaggtctatcgagtatcggtaaccaaat |
252 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6190033 |
acctaaaatcctcttcaatcttgtaggatttgttggttctttcagaacagtgtttactcctcttagtaatagaaggtctatcgagtatcgggaaccaaat |
6189934 |
T |
 |
| Q |
253 |
tttcattgtcaaatttctctttcttctc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
6189933 |
tttcattgtcaaatttctctttcttctc |
6189906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University