View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12581_low_14 (Length: 286)
Name: NF12581_low_14
Description: NF12581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12581_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 5549520 - 5549782
Alignment:
| Q |
1 |
ttttggttaataatcttcaatgtgttatgactatataaatactatgattgacatctttgacatgaaattgaaaatggtagaatcatgcttatgtaagaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5549520 |
ttttggttaataatcttcaatgtgttatgactatataaatactatgattgacacctttgacatgaaattgaaaatggtagaatcatgcttatgtaagaac |
5549619 |
T |
 |
| Q |
101 |
tgacaaccagaattcatagaaaggtaaagtataaacccaataaatcagattagtaaagtagtaaaaggtannnnnnnnaatcatttctttgctaatttcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5549620 |
tgacaaccagaattcatagaaaggtaaagtataaacccaataaatcagattagtaaagtagtaaaaggtattttttttaatcatttctttgctaatttcg |
5549719 |
T |
 |
| Q |
201 |
tcctagtaattttgatttaatttactcaacctaacacttacacgcatgtttttatgtgtgtga |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5549720 |
tcctagtaattttgatttaatttactcaacctaacacttacacgcatgtttttatgtgtgtga |
5549782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University