View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12581_low_17 (Length: 264)
Name: NF12581_low_17
Description: NF12581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12581_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 15 - 248
Target Start/End: Complemental strand, 5549516 - 5549283
Alignment:
| Q |
15 |
cttgtctctgttgatggtcaaatcatccatatttcttggtaattttctgaaccttaaaaacaactgtttnnnnnnnnnnnnnntccaatgatctcattct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5549516 |
cttgtctctgttgatggtcaaatcatccatatttcttggtaattttctgaaccttaaaaacaactgtttaaaaagaaaaaaaatccaatgatctcattct |
5549417 |
T |
 |
| Q |
115 |
tcagtcatcatgtcaaaatctgattggatgtgatataaaataaagtactaaaataatatatctaattttggaataactacaaaattattaaatattaaga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5549416 |
tcagtcatcatgtcaaaatctgattggatgtgatataaaataaagtactaaaataatatatctaattttggaatatctacaaaattataaaatattaaga |
5549317 |
T |
 |
| Q |
215 |
aacccttttattaatttctacaaatgatgttctt |
248 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
5549316 |
aacccttttattaatttctacacatgatgttctt |
5549283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University