View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12581_low_20 (Length: 246)
Name: NF12581_low_20
Description: NF12581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12581_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 3 - 242
Target Start/End: Original strand, 2018507 - 2018746
Alignment:
| Q |
3 |
gtcaatgagatggacatcactctggctctccctccgttccttcgaccttgatgacaactacttttccgacttccacaggttttccaatttcttcacctca |
102 |
Q |
| |
|
||||| |||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2018507 |
gtcaaagagatggaaaccactctggctctccttccgttccttcgaccttgatgacaactacttttccgacttccacaggttttccaatttcgtcacctca |
2018606 |
T |
 |
| Q |
103 |
tcaccacaatccattcaatccttacgcctcacttgtggctcccattttaccttcgagttcgaggacgtcgaagaagatgctttcgacctcttcctttata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018607 |
tcaccacaatccattcaatccttacgcctcacttgtggctcccattttaccttcgagttcgaggacgtcgaagaagatgctttcgacctcttcctttata |
2018706 |
T |
 |
| Q |
203 |
gactgtcgttcaaaggaattcaggaactccatctctgctt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2018707 |
gactgtcgttcaaaggaattcaggaactcgatctctgctt |
2018746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University