View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12581_low_8 (Length: 360)

Name: NF12581_low_8
Description: NF12581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12581_low_8
NF12581_low_8
[»] chr8 (3 HSPs)
chr8 (18-134)||(1322907-1323023)
chr8 (198-287)||(1322755-1322843)
chr8 (305-340)||(1322733-1322768)


Alignment Details
Target: chr8 (Bit Score: 101; Significance: 5e-50; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 18 - 134
Target Start/End: Complemental strand, 1323023 - 1322907
Alignment:
18 catcataggatgtaatttgcatttggagagcaaaattatgttaagcaaaatttttctcttttattgatacttatctaattttaataatgatgtcatgtct 117  Q
    ||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |    
1323023 catcataaggtgtaatttgcatttggagagcaaaattatgttaagcaaattttttctcttttattgatacttatctaattttaataatgatgtcatgttt 1322924  T
118 tagattttctattgaaa 134  Q
    |||||||||||||||||    
1322923 tagattttctattgaaa 1322907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 198 - 287
Target Start/End: Complemental strand, 1322843 - 1322755
Alignment:
198 agatagcttttggtgtatcatgagattgtagtttgnnnnnnnnnttgatgtagagatgcgtgtaccaggttctcattgaacgtctgattc 287  Q
    |||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||| |||||||||||||||    
1322843 agatagcttttggtgtatcatgagattgtagtttgaaattttt-ttgatgtagagatgcgtgtaccaggttctcgttgaacgtctgattc 1322755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 305 - 340
Target Start/End: Complemental strand, 1322768 - 1322733
Alignment:
305 tgaacgtctgattcatgatgagttagactttacatg 340  Q
    |||||||||||||||||||| |||||||||||||||    
1322768 tgaacgtctgattcatgatgtgttagactttacatg 1322733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University