View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12582_low_12 (Length: 229)
Name: NF12582_low_12
Description: NF12582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12582_low_12 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 229
Target Start/End: Original strand, 45440447 - 45440664
Alignment:
| Q |
12 |
cactgtgcaacaaggctttacatcaatggaagccaagcatatgcaaaacgcctggtaaccagtcaaaggatatctgcagattgacagaggaaatggtact |
111 |
Q |
| |
|
|||| |||||||| ||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45440447 |
cactatgcaacaaagctttgcatcaatggaagccaaacatatgcaaaacgcctggtaaccagtcaaaggatatctgcagattgacagaggaaatggtact |
45440546 |
T |
|
| Q |
112 |
agctatgaaaccccgcatcgtcaaaaaacattaaggtcaataaaacaagaaaattttgaattgatacctgtagtccataacaaaattagattttcctacc |
211 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45440547 |
agctatgaaaccccgcatcctcaaaaaacattaaggtcaataaaacaagaaaattttgaattgatacctgtagtccataacaaaattagattttcctacc |
45440646 |
T |
|
| Q |
212 |
ctccctagctgcaggatt |
229 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45440647 |
ctccctagctgcaggatt |
45440664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University