View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12583_high_4 (Length: 358)
Name: NF12583_high_4
Description: NF12583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12583_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 22 - 346
Target Start/End: Original strand, 35521 - 35845
Alignment:
| Q |
22 |
cttctttggttctctatggtcgccaatttgtctatcactgccatgaattttagcctaatgctaaactctgttggattctaccaagtattattctttcgtt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35521 |
cttctttggttctctatggtcgccaatttgtctatcactgccatgaattttagcctaatgctaaactctgttggattctaccaagtatttttctttcgtt |
35620 |
T |
 |
| Q |
122 |
ctttctttattcatcaactactttcattcagtttttatatgtattttgtaaggaccttcatacttggataacaacccatatgatatacacctaggatata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35621 |
ctttctttattcatcaactactttcattcagtttttatatgtattttgtaaggaccttcatacttggataacaacccatatgatatacacctaggatata |
35720 |
T |
 |
| Q |
222 |
aagttgttaattataaccttttatcacttgattgaaatcacttgtccctttttgtctcctttcatgtctattcttttgaaaaatgacaatttgtcacatt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35721 |
aagttgttaattataaccttttatcacttgattgaaatcacttgtccctttttgtctcctttcatgtctattcttttgaaaaatgacaatttgtgacatt |
35820 |
T |
 |
| Q |
322 |
gttttcaaactcgtatgttcatctc |
346 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35821 |
gttttcaaactcgtatgttcatctc |
35845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University