View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12583_high_6 (Length: 301)
Name: NF12583_high_6
Description: NF12583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12583_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 2633250 - 2633544
Alignment:
| Q |
1 |
gtggagagttgcgccgtctgcctctgtgagttcaaggcggaggatgagcaccaacggctcccaaactgccgtcacattttccatagaagctgcctggacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2633250 |
gtggagagttgcgccgtctgcctctgtgagttcaaggcggaggatgagatccaacggctcacaaactgccgtcacattttccatagaagctgcctggacc |
2633349 |
T |
 |
| Q |
101 |
gttggatgggatatgatcacactacatgtcctttgtgtcgcacaacgttcctaccacatcacatgcaagatgcatagtttgtaactactcagacttaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2633350 |
gttggatgggatatgatcacactacatgtcctttgtgtcgcacaacgttcctaccacatcacatgctagatgcatagtttgtaactactcagacttaagg |
2633449 |
T |
 |
| Q |
201 |
atgaggtgttttcttcttctgtgtatatatatattacatacgaaacaaagatgtcaaagataactttggttgatgttatgcatcaattttgttat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2633450 |
atgaggtgttttcttcttctgtgtatatatatattacatacgaaacaaagatgtcaaagataactttggttgatgttatgtatcaattttgttat |
2633544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 73 - 138
Target Start/End: Complemental strand, 41254192 - 41254127
Alignment:
| Q |
73 |
cacattttccatagaagctgcctggaccgttggatgggatatgatcacactacatgtcctttgtgt |
138 |
Q |
| |
|
|||||||||||| || | || ||||||||||||||||||||||||| | || |||||||||||| |
|
|
| T |
41254192 |
cacattttccatcgaggttgtttggaccgttggatgggatatgatcaaagaacgtgtcctttgtgt |
41254127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University