View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12583_high_9 (Length: 243)
Name: NF12583_high_9
Description: NF12583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12583_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 232
Target Start/End: Complemental strand, 44371136 - 44370900
Alignment:
| Q |
8 |
ccaacggtggtcacaattgttgctgctgtataatcaacatgtatttatcctcttgattgaaatcaaatttgattgtacagataattagaactggaattga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44371136 |
ccaacggtggtcacaattgttgctgctgtataatcaacatgtatttatcctcttgattgaaatcaaatttgattgtacagataattagaactggaattga |
44371037 |
T |
 |
| Q |
108 |
aataatttacttcaactgaagtaatttacttccccagt------------agtcacaatcagtttttgagctcggatagtttatattatttcatatggct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44371036 |
aataatttacttcaactgaagtaatttacttccccagtcacaaatgttgcagtcacaatcaatttttgagctcggatagtttatattatttcatatggct |
44370937 |
T |
 |
| Q |
196 |
aaaaatatatttgtttggtaattattttttcctcaca |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44370936 |
aaaaatatatttgtttggtaattattttttcctcaca |
44370900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University