View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12583_low_13 (Length: 249)

Name: NF12583_low_13
Description: NF12583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12583_low_13
NF12583_low_13
[»] chr1 (1 HSPs)
chr1 (1-236)||(7810467-7810702)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 7810702 - 7810467
Alignment:
1 taactatatatcttaatgaactaattaaattaagtcataagctagattactatattacggttaacgtattatgcatacctannnnnnnggatcatgctaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||       ||||||||||||    
7810702 taactatatatcttaatgaactaattaaattaagtcataagctagattactatatgacggttaacgtattatgcataccta-ttttttggatcatgctaa 7810604  T
101 actactctctctgagatactagttaagaaagtaaaaaata-nnnnnnnnnattgaaaacgatgannnnnnnactttcaataagttgaacgtgccatattt 199  Q
    ||||||||||||||||||||||||||||||||||||||||           || ||||||||||       ||||| |||||||||||||||||||||||    
7810603 actactctctctgagatactagttaagaaagtaaaaaatatcttcttttttttaaaaacgatgatttttttacttttaataagttgaacgtgccatattt 7810504  T
200 tactacataccgatacaagatttctacattagttttc 236  Q
    |||||||||||||||||||||||||||||||||||||    
7810503 tactacataccgatacaagatttctacattagttttc 7810467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University