View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12583_low_15 (Length: 236)

Name: NF12583_low_15
Description: NF12583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12583_low_15
NF12583_low_15
[»] chr6 (1 HSPs)
chr6 (20-136)||(17496522-17496638)


Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 20 - 136
Target Start/End: Complemental strand, 17496638 - 17496522
Alignment:
20 aaatggaagtgaaaacatgggagtgatgaacatgcatcgaagaagtgttgannnnnnngttggcttgaagctaaattttggaattttgtcatttaatttg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||    
17496638 aaatggaagtgaaaacatgggagtgatgaacatgcatcgaagaagtgttggtttttttgttggcttgaagctaaattttggaattttgtcatttaatttg 17496539  T
120 catgttaggtggataca 136  Q
    |||||||||| ||||||    
17496538 catgttaggttgataca 17496522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University