View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12583_low_15 (Length: 236)
Name: NF12583_low_15
Description: NF12583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12583_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 20 - 136
Target Start/End: Complemental strand, 17496638 - 17496522
Alignment:
| Q |
20 |
aaatggaagtgaaaacatgggagtgatgaacatgcatcgaagaagtgttgannnnnnngttggcttgaagctaaattttggaattttgtcatttaatttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17496638 |
aaatggaagtgaaaacatgggagtgatgaacatgcatcgaagaagtgttggtttttttgttggcttgaagctaaattttggaattttgtcatttaatttg |
17496539 |
T |
 |
| Q |
120 |
catgttaggtggataca |
136 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
17496538 |
catgttaggttgataca |
17496522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University