View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12583_low_17 (Length: 229)
Name: NF12583_low_17
Description: NF12583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12583_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 56222308 - 56222092
Alignment:
| Q |
1 |
tttcccctttttatacttcatctttatcgatcggacnnnnnnnnnnnngtatgtgggtttcactatatcttttagtaatttaattctttaaagagacgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56222308 |
tttcccctttttatacttcatctttatcgatcggacatatatatata--tatgtgggtttcactatatcttttagtaatttaattctttaaagagacgtc |
56222211 |
T |
|
| Q |
101 |
ttatcacattaccttcaatgcagggcatggttaaaaatagagctggtctggacgtggaaggaaactttgcnnnnnnnnnnnntacagctaatcaaccttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
56222210 |
ttatcacattaccttcaatgcagggcatggttaaaaacagagttggtctggacgtggaaggaaactttgcaaaaaataaaaatacagctaatcaaccttg |
56222111 |
T |
|
| Q |
201 |
tatactcccttcccctatg |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
56222110 |
tatactcccttcccctatg |
56222092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University