View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12584_low_2 (Length: 415)
Name: NF12584_low_2
Description: NF12584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12584_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 19 - 400
Target Start/End: Original strand, 13792901 - 13793282
Alignment:
| Q |
19 |
gagagataggtataaatggtaaactgtagttatggtggtttgcacctttcattgcatcggggattgttctattagagagagattggtcgttgatttgaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13792901 |
gagagataggtataaatggtaaactgtaattatggtggttagcacctttcattgcatcggggattgttctattagagagagaatggtcgttgatttgaag |
13793000 |
T |
|
| Q |
119 |
gactgatttgacggtttctgtggaggacataactatggtagttattcggcccaattttaaggacattattgggccgtggattttggagagttttgcgagg |
218 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13793001 |
gactgatttgacagtttctgtggaggacataactatggtagttattcggcccaattttaaggacattattgggccgtggattttggagagttttgcgagg |
13793100 |
T |
|
| Q |
219 |
gtttggtggggcttttgacccagttgatggagattgcctatgatggggaggccacgtggacccggtggaagtcgaggtttgtgttttatgagaaaggaat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13793101 |
gtttggtggggcttttgacccagttgatggagattgcctatgatggggaggccacgtggacccggtggaagtcgaggtttgtgttttatgagaaaggaat |
13793200 |
T |
|
| Q |
319 |
agaggatttggaggaagatgaagatgaagagaatgaggagtgtggtgttgagtgtgtccatttgttgttgttgttttggcag |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13793201 |
agaggatttggaggaagatgaagatgaagagaatgaggagtgtagtgttgagtgtgtccatttgttgttgttgttgtggcag |
13793282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University