View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12584_low_5 (Length: 308)
Name: NF12584_low_5
Description: NF12584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12584_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 22 - 248
Target Start/End: Original strand, 12355988 - 12356214
Alignment:
| Q |
22 |
aggctgaagtgagggtcattgaaaacataggactcaatctaatctcagatacgagataaaatatcacttaaatatttacgcactttcgaaatttgaaaat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12355988 |
aggctgaagtgagggtcattgaaaacataggactcaatctaatctcagatacgagataaaacatcacttaaatatttacgcactttcgaaatttgcaaat |
12356087 |
T |
 |
| Q |
122 |
caaattgagatgattagagttatccatgaggaatgtgattacagttttacaaagatcacaagaaccaagcatagtggttatcgaatttgcttttgtggca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12356088 |
caaattgagatgattagagttatccatgaggaatgtaattacagttttacaaagatcacaagagccaagcatagtggttatcgaatttgcttttgtggca |
12356187 |
T |
 |
| Q |
222 |
tcaaatggcatataagtgtgttgcttg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||| |
|
|
| T |
12356188 |
tcaaatggcatataagcgtgttgcttg |
12356214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 146 - 234
Target Start/End: Original strand, 12395021 - 12395109
Alignment:
| Q |
146 |
catgaggaatgtgattacagttttacaaagatcacaagaaccaagcatagtggttatcgaatttgcttttgtggcatcaaatggcatat |
234 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| || | ||||||||||||||| || || | |||||||||||| ||||||||||| |||| |
|
|
| T |
12395021 |
catgaggaatgtgattacagctttaccaagttcgcgagaaccaagcatagttgtaatggcatttgcttttgtagcatcaaatggtatat |
12395109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University