View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12584_low_8 (Length: 231)
Name: NF12584_low_8
Description: NF12584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12584_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 19 - 212
Target Start/End: Original strand, 17107711 - 17107904
Alignment:
| Q |
19 |
actctttacgtggagtgaggttttaaacctaacttgtaacatcaaatcagaccacagggctggatctgcatatctggaattgatcaggagtattgtggac |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17107711 |
actctttacgtggagtgaggttttatacctaacttgcaacatcaaaccagttcacagggctggatcagcatatctggaattgatcaggagtattgtggac |
17107810 |
T |
|
| Q |
119 |
acctatatgcatcgacaacaatacaagtaagtctaatttttatcgaagctttgatcactatgctagaattctagtagatattgatctttctgga |
212 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||| |
|
|
| T |
17107811 |
acctatatgcatcgacaacaatactagcaagtctaatttttatcgaagctttgatcaccatgctagaattctggtagatgttgatctttctgga |
17107904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University