View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12585_low_11 (Length: 302)
Name: NF12585_low_11
Description: NF12585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12585_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 19 - 213
Target Start/End: Original strand, 40135739 - 40135933
Alignment:
| Q |
19 |
cacagaaattatcagtgcaatatacaccaccaaaaaattatgtatttgacttgttcggattacaaaatgaaatctaaagtgttcctcaccctacagaata |
118 |
Q |
| |
|
|||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
40135739 |
cacagaaattgccattgcaatatagaccaccaaaaaattatgtatttgacttgttcggattacaaaatgaaatctaaagtgttcctcatcctacaaaata |
40135838 |
T |
 |
| Q |
119 |
cgagttttaacacaatctaaccgataaaaatgccttagattaattagaaggtaaaagttgatttttaatataagttggtaaatgatctttgttag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40135839 |
cgagttttaacacaatctaaccgataaaaatgccttagattaattagaaggtaaaagttgatttttaatataagttggtaaatgatctttgttag |
40135933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University