View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12585_low_15 (Length: 250)
Name: NF12585_low_15
Description: NF12585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12585_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 6358925 - 6358705
Alignment:
| Q |
1 |
ttgctttatctgttccttgtacctaactaacccacattcttggcattggaatgattttccatcttcagtttagacagatcaagnnnnnnnnnnnnncaaa |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6358925 |
ttgctttatctattccttgtacctaactaacccacattcttggcattggaatgattttccatcttcagtttagacagatcaagaagaaaaaaaaaaaaaa |
6358826 |
T |
 |
| Q |
101 |
------ggtctcgaatccaagttttgctgagtatgcataaataatctttgaatgacatttcttgctctataagtgaacttattattgcaaatggtaactt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358825 |
aaaaaaggtctcgaatccaagttttgctgagtatgcataaataatctttgaatgacatttcttgctctataagtgaacttattattgcaaatggtaactt |
6358726 |
T |
 |
| Q |
195 |
ctacttagacgagataaaaaa |
215 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6358725 |
ctacttagacgagataaaaaa |
6358705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 32857567 - 32857631
Alignment:
| Q |
1 |
ttgctttatctgttccttgtacctaactaacccacattcttggcattggaatgattttccatctt |
65 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
32857567 |
ttgctttatctcttccttgtctctaactaacccacattcttggcattgaaatgcttttccatctt |
32857631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University