View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12585_low_18 (Length: 242)
Name: NF12585_low_18
Description: NF12585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12585_low_18 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 20 - 242
Target Start/End: Original strand, 37396711 - 37396933
Alignment:
| Q |
20 |
ccttcatgctaaatgacatcatcaattggcaatataagcacatatacggaaatattattcataaaaaccttatgtaccttaactaattacaaggttaact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37396711 |
ccttcatgctaaatgacatcatcaattggcaatataagcacatatacggaaatattattcataaaaaccttatgtaccttaactaattacaaggttaact |
37396810 |
T |
 |
| Q |
120 |
cgaaaactttccatnnnnnnnntaatcattgaagattagacctaattaacccatttaaactttacatgcatgtaaacatatttcatgactatcatgcttg |
219 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37396811 |
cgaaaactttccataaaaaaaataatgattgaagattagacctaattaacccatttaaactttacatgcatgtaaacatatttcatgactctcatgcttg |
37396910 |
T |
 |
| Q |
220 |
aacaacttccctttctcaatacc |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37396911 |
aacaacttccctttctcaatacc |
37396933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University