View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12586_high_6 (Length: 310)
Name: NF12586_high_6
Description: NF12586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12586_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 20 - 296
Target Start/End: Complemental strand, 54082502 - 54082226
Alignment:
| Q |
20 |
agtcagtcagattccagcaacttattagctctggaatctggatttgatccacaaagattttctcaagggcttaccggaaaatcgtcttggcaaggattgg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54082502 |
agtcagtcagattccagcaacttattagctctggaatctggatttgatccacaaagattttctcaagggcttaccggaaaatcatcttggcaaggattgg |
54082403 |
T |
 |
| Q |
120 |
aagttcctactaaacagaattctgtttcacttgctactgacctaaatgggataataggggctacaagttcacgcagttccaatgtggagactggtcctca |
219 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54082402 |
aagttcctactaaacagaattccgtttcacttgctactgacctaaatgggataataggggcaacaagttcacgcagttccaatgtggagactggtcctca |
54082303 |
T |
 |
| Q |
220 |
gctgcagccaaatcttgcactgcagctatgatgatatattatttttcagatgggaattttctcattgaattttcaaa |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54082302 |
gctgcagccaaatcttgcactgcagctatgatgatatattatttttcagatgggaattttctcattgaattttcaaa |
54082226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University