View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12586_high_8 (Length: 250)
Name: NF12586_high_8
Description: NF12586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12586_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 55586 - 55360
Alignment:
| Q |
1 |
aagaattgagtaaagcaaaggaatgagagggatgacgacgagaagcagaggctttgatggcctgagcagcaagggaattagtattgataattggaggagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55586 |
aagaattgagtaaagcaaaggaatgagagggatgacgacgagaagcagaggctttgatggcctgagcagcaagggaattagtattgataattggaggagc |
55487 |
T |
|
| Q |
101 |
gctatttggttcattatcatctaacaattcatgtcgcccattaatattaatatcttccttgaaggtcgaactccttgatacaacctgctttctcctatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55486 |
gctatttggttcattatcatctaacaattcatgtcgcccattaatattaatatcttccttgaaggtcgaactccttgatacaacctgctttctcctatat |
55387 |
T |
|
| Q |
201 |
gccattatcaatcaaccaccgtaaccc |
227 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
55386 |
gccattatcaatcaaccaccgcaaccc |
55360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 27702163 - 27702225
Alignment:
| Q |
15 |
gcaaaggaatgagagggatgacgacgagaagcagaggctttgatggcctgagcagcaagggaa |
77 |
Q |
| |
|
||||||||| ||| ||| |||||||||| || ||||||||||||||| ||||| || |||||| |
|
|
| T |
27702163 |
gcaaaggaaagagcgggttgacgacgagcagtagaggctttgatggcttgagcggcgagggaa |
27702225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University