View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12586_low_5 (Length: 334)
Name: NF12586_low_5
Description: NF12586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12586_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 20 - 309
Target Start/End: Original strand, 28721828 - 28722115
Alignment:
| Q |
20 |
tactgtatatgaatttaagttgttcatatgatccatgtctatttgaatttaattgaatttttgttttgttttgtgtatcactttgtcaatcggcatcacc |
119 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||| || |||| |||||||||||||||| ||| ||||| |
|
|
| T |
28721828 |
tactttatatgaattttagttgttcatatgatccatgtctatttgagtttaattgaaacttattttt----tgtgtatcactttgtccatcagcatcttt |
28721923 |
T |
|
| Q |
120 |
ttttattattttgtt-aaatcaactttgctgatacgtgattacatttcttttggtttaaatgataaattaagtttgacctggttatttaatttagaaaca |
218 |
Q |
| |
|
|||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28721924 |
tttt-ttattttgtttaaatccactttgctgatacgtgattacatttcttttggtttaaatgataaattaagtttgacctggttatttaatttagaaaca |
28722022 |
T |
|
| Q |
219 |
aactctttatgtttatttcattttattagatttggcacatccagatcggtgcatc--gtctttgttgaaccatggtcttgtatgctatacctt |
309 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||| ||||||||||||| ||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
28722023 |
aactctttatgtttattttattttattcaatttggcacatctagatcggtgcatctagtctttgttaaacaatggtcttgtatgctatacctt |
28722115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University