View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12586_low_7 (Length: 286)
Name: NF12586_low_7
Description: NF12586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12586_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 469501 - 469285
Alignment:
| Q |
19 |
ttaatatgtattagtatcagacagataacgtgtctagacacgcatgagtggaactgagagttagaagcgattgaatgtaattatatatgtcggtagtaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
469501 |
ttaatatgtattagtatcagacagataacgtgtttagacacgcatgagtggaactgagagttagaagcgattgaatgtaattatatatgtccgtagtaat |
469402 |
T |
|
| Q |
119 |
ttgagaaaatggaagttataattagaaacgactgagtgtaatcatatgcgtcacatatcatatggcatgtatgagacatgtcttcaatatgaagtctcaa |
218 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
469401 |
ttgagaaaatggaagttatagttagaaacgattgagtgtaatcatatgtgtcacatatcatatggcatgtatgagacatgtcttcaatatgaagtctcaa |
469302 |
T |
|
| Q |
219 |
tactacatatcatatga |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
469301 |
tactacatatcatatga |
469285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University