View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12587_low_8 (Length: 245)
Name: NF12587_low_8
Description: NF12587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12587_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 44153808 - 44154025
Alignment:
| Q |
18 |
aaataatgacataaaagagtgttgctgccgagttaaccaagatttaagctcactatgagagcaatgacaaaaactaggagcatcctatggcctcctcaat |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44153808 |
aaataataacataaaagagtgttgctgccgagttaaccaagatttaagctcactatgagagcaatgacaaaaactaggagcatcctatggcctcctcaat |
44153907 |
T |
 |
| Q |
118 |
attctgttgtttaaattattatgacattagaagacaaaaacataatttattagtagtcgatcttctcaagttaaacttaaatttgagcaaaagaatactt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44153908 |
attctgttgtttaaattattatgacattagaagacaaaaacataatttattagtagtcgatcttctcaagttaaactcaaatttgagcaaaagaatactt |
44154007 |
T |
 |
| Q |
218 |
tctttctcaatcttcttc |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44154008 |
tctttctcaatcttcttc |
44154025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University