View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12589_low_5 (Length: 223)
Name: NF12589_low_5
Description: NF12589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12589_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 32781123 - 32780932
Alignment:
| Q |
17 |
catcatgaccgaaattcctggagctggttgacgacaatggagaagccgtattcgtttctgttccaaggtagtctgcccatctagatggaccatcccattc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32781123 |
catcatgaccgaaattcctggagctggttgacgacaatggagaagccgtatttgtttctgttccaaggtagtctgcccatctagatggaccatcccattc |
32781024 |
T |
 |
| Q |
117 |
ccttgatcttgccgcagtcggcgataatgaagaatcctggttcgatgatttttgcctcgacttcgccataaactaataataatccgtctctg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32781023 |
ccttgatcttgccgcagtcggcgataatgaagaatcctggttcgatgatttttgcctcgacttcgccataaactaataataatccgtctctg |
32780932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University