View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_high_21 (Length: 344)
Name: NF1258_high_21
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 152 - 248
Target Start/End: Complemental strand, 36804177 - 36804081
Alignment:
| Q |
152 |
atataatctaactttttaaacggagctttgatacttgaaagggatgttaactcatcttctgtaacttcaattatggggttgtacattcgttgcaact |
248 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36804177 |
atataatttaactttttaaatagagctttgatacttgagagggatgttaactcatcttctgtaacttcaattatggggttgtacattcgttgcaact |
36804081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 14 - 53
Target Start/End: Complemental strand, 36804753 - 36804714
Alignment:
| Q |
14 |
aatattaacattgatttctctcttgggagccgtcgtcgtc |
53 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
36804753 |
aatattaacattgatttctcttttgggagccgtcgccgtc |
36804714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University