View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_high_23 (Length: 338)
Name: NF1258_high_23
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 29 - 280
Target Start/End: Complemental strand, 52552335 - 52552084
Alignment:
| Q |
29 |
aacctttgactaagctcaccaatttgggccctcaaaattgaattttctgcctcaacattcaaatagtgctgtgttgtgatatttatgctattcagaattt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52552335 |
aacctttgactaagctcaccaatttgggccctcaaaattgaattttctgcctcaacattcaaatagtgttgtgttgtgatatttatgctattcagaattt |
52552236 |
T |
|
| Q |
129 |
cactgttgtgttttgtgagttgagacatctgactcatcatatcatcaacatgtttatgctttctcatcctacatctttttgctgattcacgattcgattg |
228 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52552235 |
cactgttgtcttttgtgagttgagacatctgactcatcatatcatcaacatgtttatgctttctcatcctacatctttttgctgattcacgattcgattg |
52552136 |
T |
|
| Q |
229 |
ctttctcttattttttctttgatccatcaaatccttctccggtccagaactc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52552135 |
ctttctcttattttttctttgatccatcaactccttctccggtccagaactc |
52552084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 272 - 328
Target Start/End: Original strand, 52549356 - 52549412
Alignment:
| Q |
272 |
ccagaactcctactttgctgtgacaactatgggacatctattgatgtatggtctgtg |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52549356 |
ccagaactcctactttgctgtgacaactatgggacatctattgatgtatggtctgtg |
52549412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 185 - 255
Target Start/End: Complemental strand, 7235486 - 7235416
Alignment:
| Q |
185 |
tgctttctcatcctacatctttttgctgattcacgattcgattgctttctcttattttttctttgatccat |
255 |
Q |
| |
|
||||| |||||||| ||||| |||| ||||| || ||||||||||||||||| |||||||||||||||| |
|
|
| T |
7235486 |
tgcttcctcatccttgatcttcttgccgattcgcggttcgattgctttctcttcctttttctttgatccat |
7235416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University