View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_high_26 (Length: 309)
Name: NF1258_high_26
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 51 - 241
Target Start/End: Complemental strand, 28249504 - 28249314
Alignment:
| Q |
51 |
atgtgtcgttggtgagagagaatgaggagttacgatcggagttgacgaagatgaagatgtacattacggatatgcagcagcagaagaacgttacgcctgg |
150 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28249504 |
atgtatcgttggtgagagagaatgaggagttacgatcagaattgacgaagatgaagatgtacattacggatatgcagcagcagaagaacgttacgcctgg |
28249405 |
T |
 |
| Q |
151 |
aacaacgtcggtgagttcgagtaagaagacgacgnnnnnnncttctgtgtcgaaaaaactgggaaagttgttcaaaaatggggctaaggat |
241 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28249404 |
aacgacgtcgttgagttcgagtaagaagacgacgtttttttcatctgtgtcgaaaaaactgggaaagttgttcaaaaatggggctaaggat |
28249314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University