View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1258_high_33 (Length: 252)

Name: NF1258_high_33
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1258_high_33
NF1258_high_33
[»] chr1 (1 HSPs)
chr1 (1-242)||(2124537-2124788)


Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 2124537 - 2124788
Alignment:
1 tttatctacccctaagtacgtatatatacgaacaatggtacgtacgtgtcttaatgaagacgaagcaaatgcatatgcatatacttta-agtatgaaatg 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||    
2124537 tttatctacccctaagtacgtatatatacgaacaatggtacgtacgtgtcttaatgaagacgaagcagatgcatatgcatatactatatagtatgaaatg 2124636  T
100 aaatga---------tgacaatgataaaaatggttaatggtatgtggcatgcattccatttctgtcctcaccatcagtcttccatctgatatgatcagtc 190  Q
    ||||||         ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2124637 aaatgatgacgatgatgacaataataaaaatggttaatggtatgtggcatgcattccatttctgtcctcaccatcagtcttccatctgatatgatcagtc 2124736  T
191 cctatgcatgccataccatgacaatatatactttgcatagatacgctctctg 242  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
2124737 cctatgcatgccataccatgacaatatatactttgcatagatacgctctctg 2124788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University