View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_high_33 (Length: 252)
Name: NF1258_high_33
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 2124537 - 2124788
Alignment:
| Q |
1 |
tttatctacccctaagtacgtatatatacgaacaatggtacgtacgtgtcttaatgaagacgaagcaaatgcatatgcatatacttta-agtatgaaatg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||| |
|
|
| T |
2124537 |
tttatctacccctaagtacgtatatatacgaacaatggtacgtacgtgtcttaatgaagacgaagcagatgcatatgcatatactatatagtatgaaatg |
2124636 |
T |
 |
| Q |
100 |
aaatga---------tgacaatgataaaaatggttaatggtatgtggcatgcattccatttctgtcctcaccatcagtcttccatctgatatgatcagtc |
190 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2124637 |
aaatgatgacgatgatgacaataataaaaatggttaatggtatgtggcatgcattccatttctgtcctcaccatcagtcttccatctgatatgatcagtc |
2124736 |
T |
 |
| Q |
191 |
cctatgcatgccataccatgacaatatatactttgcatagatacgctctctg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2124737 |
cctatgcatgccataccatgacaatatatactttgcatagatacgctctctg |
2124788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University