View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_high_34 (Length: 251)
Name: NF1258_high_34
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_high_34 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 36457142 - 36457382
Alignment:
| Q |
11 |
cataggggagtggattaataatgggtggtcatagaggctatcttggaagcgtaatgctattgattgggaggcctaactggtgcagaatttgaatacgctg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457142 |
cataggggagtggattaataatgggtggtcatagaggctatcttggaagcgtaatgctattgattgggaggcctaactggtgcagaatttgaatacgctg |
36457241 |
T |
 |
| Q |
111 |
ctgctgtcagcgtctccaaggcaggaccagcctgatactgggtctggaaactagaatctacgcagagattcagctgcaaaagctgatgtagaatgctgtc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457242 |
ctgctgtcagcgtctccaaggcaggaccagcctgatactgggtctggaaactagagtctacacagagattcagctgcaaaagctgatgtagaatgctgtc |
36457341 |
T |
 |
| Q |
211 |
agatttatatgcaggcgacgagtttagagcagcatatcacc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
36457342 |
agatttatatgcaggcgacgagtttaaagtagcatatcacc |
36457382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University