View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1258_high_42 (Length: 203)

Name: NF1258_high_42
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1258_high_42
NF1258_high_42
[»] chr5 (1 HSPs)
chr5 (79-175)||(43054648-43054744)


Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 79 - 175
Target Start/End: Original strand, 43054648 - 43054744
Alignment:
79 acaaaattaccaatggttagttttcttattctttttcaaaggagtatggttttttcattcggagatacaggtttctttcttgctcttatttagattt 175  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
43054648 acaaaattaccaatggttagttttcttattctttttcaaaggagtatggttttttcattcggagatacaagtttctttcttgctcttatttagattt 43054744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University