View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_high_43 (Length: 202)
Name: NF1258_high_43
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_high_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 10434679 - 10434862
Alignment:
| Q |
1 |
gatagtatcaacattatggttgtctaagtaaaactgaattcaaattcctttaacagatctgtgaggttgaactttgtgcaaattgtatacaa--tttgaa |
98 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
10434679 |
gatagtatcaacattatgcttgtctaagtaaaactgaattcaaattcctttaacagatctgtgaggttgaactttgtgcaaattgtatacaatttttaaa |
10434778 |
T |
 |
| Q |
99 |
ctcatttgtaatttatatgaagcgcagttacggatacactgacaccgataatagcttgaaaaaatgacatgcttcagtataatc |
182 |
Q |
| |
|
|||||||||| |||||||||||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10434779 |
ctcatttgtagtttatatgaagcacggttacggatacactgacacctataatagcttgaaaaaatgacatgcttcagtataatc |
10434862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University