View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_low_38 (Length: 316)
Name: NF1258_low_38
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 130 - 206
Target Start/End: Complemental strand, 11103649 - 11103573
Alignment:
| Q |
130 |
tacatatattaattagatgcaaattaagtatatattaaaatcatacaatagcacaaataggataactagattaaggt |
206 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11103649 |
tacatatattaattagatggaaattaagtatatattaaaatcatacaatagcacaaataggataactagattaaggt |
11103573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 159 - 229
Target Start/End: Complemental strand, 11590066 - 11589998
Alignment:
| Q |
159 |
atatattaaaatcatacaatagcacaaata-ggataactagattaaggtacgtaacaaaatattacatttct |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
11590066 |
atatattaaaatcatacaatagcacaaatagggataactagattaaggt---taaaaaaatattacatttct |
11589998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University