View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_low_42 (Length: 303)
Name: NF1258_low_42
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 35273675 - 35273965
Alignment:
| Q |
1 |
aaaaatccgttatggaggcagcagaattggcggataagaatatgacttttgaagttatttattatccgacggctagtcattggtgtaattttgttggaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
35273675 |
aaaaatccgttatggaggcagcagaattggcggataagaatatgacttttgaagttatttattatccgacggctagtcattggtgtaattttgtggtgga |
35273774 |
T |
|
| Q |
101 |
tgctgaagctgtaaagaaagcaatgcagattaattggcaatctggaatgagagttaaacattgcttgaagactgatgaatcttcaaagagaagctcaatt |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35273775 |
tgctgaagccgtaaagaaagcaatgcagattaattggcaatctggaatgagagttaaacattgcttgaagactgatgaatcttcaaagagaagctcaatt |
35273874 |
T |
|
| Q |
201 |
tttcaagggacagtatctgctctatctgatccttctcatcatccatggcgtatgcttcaggtatatatgatttcttcttttggtgtatatt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35273875 |
tttcaagggacagtatctgctctatctgatccttctcatcatccatggcgtatgcttcaggtatatatgatttcttcttttggtgtatatt |
35273965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 17976445 - 17976350
Alignment:
| Q |
1 |
aaaaatccgttatggaggcagcagaattggcggataagaatatgacttttgaagttatttattatccgacggctagtcattggtgtaattttgttg |
96 |
Q |
| |
|
||||||| ||| |||||||| ||||||||||||||||| || ||||||||||| | |||||||| ||||||| ||||||||||||||||| |
|
|
| T |
17976445 |
aaaaatcgtttacggaggcagtggaattggcggataagaacttggcttttgaagttgtgtattatccaacggctaaaggttggtgtaattttgttg |
17976350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University