View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_low_47 (Length: 283)
Name: NF1258_low_47
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 14 - 254
Target Start/End: Original strand, 47933299 - 47933538
Alignment:
| Q |
14 |
agaggaagaaaaattacagggtttgaatcatgtatttttctgatggtcattacttccgcgtatattctgtaggatcagtttgaaaaattgaccttttttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47933299 |
agaggaagaaaaattacagggtttgaatcatgtatttttctgatggtcattacttc-gcgtatattctgtaggatcagtttgaaaaattgaccttttttc |
47933397 |
T |
|
| Q |
114 |
cgaaaattccaagggaatgaaaccaagtggccattgcctccatgagatgatcttcttcttcgttgaacaagtctaagatagaatcgtcttggcaatcaag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47933398 |
cgaaaattccaagggaatgaaaccaagtggccattgcctccatgagatgatctgcttcttcgttgaacaagtctaagatagaatcgtctaggcaatcaag |
47933497 |
T |
|
| Q |
214 |
ttgactatcaaattcaccttattttaatgatgtgaggtcag |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47933498 |
ttgactatcaaattcaccttattttaatgatgtgaggtcag |
47933538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University