View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_low_48 (Length: 281)
Name: NF1258_low_48
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 60 - 242
Target Start/End: Original strand, 28054794 - 28054976
Alignment:
| Q |
60 |
agtatggtagtaatattttatggagaaggaaagcaatgcaatttgctggttgagaggatcatggaatggaatatcgaagtgggtgggaaatcgtagataa |
159 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28054794 |
agtatgttagtaatattttatggagaaggaaagcaatgcaatttgctagttgagaggatcatggaatggaatattgaagtgggtgggaaatcgtagataa |
28054893 |
T |
 |
| Q |
160 |
aatatgaattaaattttggtttgttaatgtatgcatgtggtatagtgtgcacccattgttataataggacacgtcatattgtt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28054894 |
aatatgaattaaattttggtttgttaatgtatgcatgtggtatagtgtgcacccattgttataataggacacgtcatattgtt |
28054976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 193 - 239
Target Start/End: Complemental strand, 40361500 - 40361454
Alignment:
| Q |
193 |
catgtggtatagtgtgcacccattgttataataggacacgtcatatt |
239 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
40361500 |
catgtggtatgatgtgcacccattgttataacaggacacctcatatt |
40361454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University