View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_low_51 (Length: 274)
Name: NF1258_low_51
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_low_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 6 - 152
Target Start/End: Complemental strand, 22198414 - 22198268
Alignment:
| Q |
6 |
aataacgatctcttcttgatcgtgagtttgatggagagatggattgaggtggtgagagggagaacgagtgaacggtgaggtgaaaaaacgagatcaatag |
105 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22198414 |
aataacgatctcttcttcatcgtgagtttgatggagagatggattgaggtggtgagagggagaacgagtgaacggtgaggtgaaaaaacgagatcaatag |
22198315 |
T |
|
| Q |
106 |
agaaaaatatgtgatgggtttaccatttatgagtaggttctgtggtg |
152 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
22198314 |
agaaaaatatgtgatgggtttacgatttatgagaaggttctgtggtg |
22198268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 8 - 152
Target Start/End: Complemental strand, 6814359 - 6814227
Alignment:
| Q |
8 |
taacgatctcttcttgatcgtgagtttgatggagagatggattgaggtggtgagagggagaacgagtgaacggtgaggtgaaaaaacgagatcaatagag |
107 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| ||| ||||| ||| ||| |||||||||||||||||| ||||| ||| |
|
|
| T |
6814359 |
taacgatctcttcttcattgtgagtttgatggagagatgga------------gagtgagaaagagggaaaggtgaggtgaaaaaacgatttcaattgag |
6814272 |
T |
|
| Q |
108 |
aaaaatatgtgatgggtttaccatttatgagtaggttctgtggtg |
152 |
Q |
| |
|
|| |||||||||||||| | | ||||||||| ||||| ||||||| |
|
|
| T |
6814271 |
aagaatatgtgatgggtatgcgatttatgagaaggttttgtggtg |
6814227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 133
Target Start/End: Complemental strand, 6098146 - 6098033
Alignment:
| Q |
25 |
tcgtgagtttgatggagagatggattgaggtggtgag------agggagaacgagtgaacggtgaggtgaaaaaacgagatcaatagagaaaaatatgtg |
118 |
Q |
| |
|
|||||||||||||||| ||||||||| || ||||||| || ||||||||||||| ||||||||| |||||||| ||||| ||||| ||| |||| |
|
|
| T |
6098146 |
tcgtgagtttgatggaaagatggattaagatggtgagtgaggaagtgagaacgagtgaaaagtgaggtga-aaaacgagttcaattgagaagaatttgtg |
6098048 |
T |
|
| Q |
119 |
atgggtttaccattt |
133 |
Q |
| |
|
|||||| ||| |||| |
|
|
| T |
6098047 |
atgggtatacgattt |
6098033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University