View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_low_53 (Length: 258)
Name: NF1258_low_53
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 3 - 229
Target Start/End: Original strand, 44000486 - 44000706
Alignment:
| Q |
3 |
caagatgcagaatgatttgaaggtttactgaatagtattaccggtagctgctagaaattgatttgaagaaaaagggacagggaaaagagtgaaggaggtg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44000486 |
caagatgcagaatgatttgaaggtttactgaatagtattaccggtagctgctagaaattgatttgaagaaaaagggacagggaaaagagtgaaggaggtg |
44000585 |
T |
 |
| Q |
103 |
gagcaacttttttcttattagatgcatcaaagaataaactttcaggatacgccccttcactatactagtgtgcggtattttcataagcaaatattagttg |
202 |
Q |
| |
|
|| ||||| || |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44000586 |
gaacaact------ttcttagatgcatgaaagaataaactttcaggatacgccccttcactatactagtgtgcggtattttcataagcaaatgttagttg |
44000679 |
T |
 |
| Q |
203 |
ttaatttgttaggggatattaatttgc |
229 |
Q |
| |
|
|||||||||||||||||| ||||||| |
|
|
| T |
44000680 |
ttaatttgttaggggatacgaatttgc |
44000706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University