View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_low_59 (Length: 251)
Name: NF1258_low_59
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_low_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 2124481 - 2124261
Alignment:
| Q |
1 |
tagtacgctacagattttaatagtacgatgtacttctatacctttttcatataagaaagttttctttaacaagtccaaatacaacatgaatgttacaact |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2124481 |
tagtacgctacagatc--aatagtacgatgtacttctatacctttttcatataagaaagttttctttaacaagtccaaatacaacatgaatgttacaact |
2124384 |
T |
|
| Q |
101 |
aagaaacggtatccaaatatataaaatgattaagccactaaagaaacagtatccaaacttataaaatgattaagccactaagggtgaaaagatgatcaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2124383 |
aagaaacggtatccaaatatataaaatgattaagccactaaagaaacagtatccaaacttataaaatgattaagccactaaggatgaaaagatgatcaaa |
2124284 |
T |
|
| Q |
201 |
tcaattttaataaggacggtttt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2124283 |
tcaattttaataaggacggtttt |
2124261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University