View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_low_62 (Length: 251)
Name: NF1258_low_62
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_low_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 193817 - 193595
Alignment:
| Q |
1 |
tggtgcactagaaagtcactatatctttatatatacgcatttggacttgtaggtatatgtacctacctcaccccaatttgaggtataattaaactgatga |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
193817 |
tggtgcactagaaagtcactatatccttatatatacgcatttggacttgtaggtatatgtacctacctcaccccaatttgaggtataattaaactgatga |
193718 |
T |
 |
| Q |
101 |
atgttgattgcagtttttagtacaaggtttgccatatttagcagataattgagcatatggggaataccacaaaaatacaaataatatagcatatatatag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
193717 |
atgttgattgcagtttttagtacaaggtttgccatctttagcagataattgagcatacggggaataccacaaaaatacaaataatatagcatatatatag |
193618 |
T |
 |
| Q |
201 |
ttttcaatattcatttcacaagt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
193617 |
ttttcaatattcatttcacaagt |
193595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University