View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_low_63 (Length: 251)
Name: NF1258_low_63
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_low_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 3641957 - 3641703
Alignment:
| Q |
1 |
tttactttatctatgtgatttaatgatatttgtatagattccttctagccaccaggtaacatcagtgaaaatatatga---agtttgatccggtgacatc |
97 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3641957 |
tttactttatctatgtgatttaatgttatttgtatagattccttctagccaccaggtaacatcagtgaaaatatatgatgaagtttgatccggtgacatc |
3641858 |
T |
 |
| Q |
98 |
gtgaatttgattcttgcaacaacacgttggccaaattttgacttcatttataactt---------ttgatacgatcctttctctctgtaaacactatatg |
188 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
3641857 |
gtgaatttgattcttgtaacaacatgttggccaaattttgacttcatttataacttttgaaccttttgatacgatcctttctctctgtaaacattatatg |
3641758 |
T |
 |
| Q |
189 |
gttagtctcttaaaattcattcagagtctgctgaattcagcaactgccctatgat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3641757 |
gttagtctcttaaaattcattcagagtctgctgaattcagcaactgccctctgat |
3641703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University