View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258_low_68 (Length: 208)
Name: NF1258_low_68
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258_low_68 |
 | |
|
| [»] scaffold0603 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 4184387 - 4184331
Alignment:
| Q |
1 |
tcactagaaacagtcttgtctaacagcaccttcacagaagttgagagtgagcagagt |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4184387 |
tcactagaaacaatcttgtctaacagcaccttcacagaagttgagagtgagcagagt |
4184331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 3 - 79
Target Start/End: Complemental strand, 5964992 - 5964916
Alignment:
| Q |
3 |
actagaaacagtcttgtctaacagcaccttcacagaagttgagagtgagcagagttgtagaaaagatttatcaacca |
79 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||||| |||||||||| |||||||| | ||||| |||||||| |
|
|
| T |
5964992 |
actagaaacaatcttgtttaacaacaccttcacagaagctgagagtgagacgagttgtataggagattcatcaacca |
5964916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0603 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: scaffold0603
Description:
Target: scaffold0603; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 5644 - 5798
Alignment:
| Q |
1 |
tcactagaaacagtcttgtctaacagcaccttcacagaagttgagagtgagcagagttgtagaaaagatttatcaaccaaatc---tttaggaggaattt |
97 |
Q |
| |
|
|||||||||||| |||||| |||||||| ||||||| ||||||||||| ||| ||||||| ||||||||||||||||| | || | |||| || |
|
|
| T |
5644 |
tcactagaaacaatcttgtttaacagcagtgacacagaaattgagagtgagtagaattgtagagaagatttatcaaccaaaacagaatttgtaggagttc |
5743 |
T |
|
| Q |
98 |
gattccaatcacttttgaaaacacctaattcacctacatgttctcccgaactcaa |
152 |
Q |
| |
|
|| ||||||||||||||||||| ||||| || || ||||||||||||||||| |
|
|
| T |
5744 |
cataccaatcacttttgaaaacatttaatttgccaacctgttctcccgaactcaa |
5798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University