View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12590_low_14 (Length: 398)
Name: NF12590_low_14
Description: NF12590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12590_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 20 - 204
Target Start/End: Complemental strand, 9604571 - 9604395
Alignment:
| Q |
20 |
tgcaatacagatccaagctgttccaatgatccaagcgtgcatgcttacacacttcatgtgttgctcatggagcaatggaaggtcacatacttacactcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9604571 |
tgcaatacagatccaagctgttccaatgatccaagcgtgcatgcatacgcacttcatgtgttgctcatggagcaatggaaggtcacatacatacactcaa |
9604472 |
T |
|
| Q |
120 |
gcgttcactacatttgtttcttaatatttatcacattttggctgcaagaccgaacaaaggttttggtcaaaaatagtgatttata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9604471 |
gcgttcactacatttgtttcttaatatttatcacattttggct--------gaacaaaggttttggtcaaaaatagtgatttata |
9604395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 274 - 381
Target Start/End: Complemental strand, 9604324 - 9604217
Alignment:
| Q |
274 |
gagcaaccatcatcatgtcatctttttcttgtgtaagaatttgcagcagtctcacaacacaattagagtggcatgctttacatgtgaattggtgtcttga |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9604324 |
gagcaaccatcatcatgtcatctttttcttgtgtaggaatttgcagcagtctcacaacacaattagagtggcatgctttacatgtgaattgatgtcttga |
9604225 |
T |
|
| Q |
374 |
gctcatca |
381 |
Q |
| |
|
|||||||| |
|
|
| T |
9604224 |
gctcatca |
9604217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University