View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12590_low_20 (Length: 340)
Name: NF12590_low_20
Description: NF12590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12590_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 160 - 328
Target Start/End: Complemental strand, 7217556 - 7217388
Alignment:
| Q |
160 |
ctaacccagcaacccaagtaagaagaaagacaacagaaacaccatggctagacttagcacgaaaattagtgataatttgaggaatttcagcaacacccca |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7217556 |
ctaacccagcaacccaagtaagaagaaagacaatagaaacaccatggctagacttagcacgaaaattagtgataatttgaggaatttcagcaacacccca |
7217457 |
T |
|
| Q |
260 |
acaaattaaactgatgaatccaaaagtgaatgaaatgttatcattaacattgcagagacagtcagtgaa |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7217456 |
acaaattaaactgatgaatccaaaagtgaatgaaatgttatcattaacattgcagagacagtcactgaa |
7217388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 16 - 73
Target Start/End: Complemental strand, 7217682 - 7217625
Alignment:
| Q |
16 |
agaatgacataccgtagctggttcaagaagacaaccgaccagattgaatatgtctctg |
73 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7217682 |
agaatgacataccgtagctggttctagaagacaaccgaccagattgaatatgtctctg |
7217625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 322
Target Start/End: Original strand, 33355565 - 33355727
Alignment:
| Q |
160 |
ctaacccagcaacccaagtaagaagaaagacaacagaaacaccatggctagacttagcacgaaaattagtgataatttgaggaatttcagcaacacccca |
259 |
Q |
| |
|
||||||| || ||||||||||| |||||| ||| |||| |||||||| ||||| |||||| | ||||| || ||||||||||||||||| ||||| |
|
|
| T |
33355565 |
ctaaccctgctacccaagtaaggagaaaggcaagggaaattccatggcttgacttgttgcgaaaaatggtgattatctgaggaatttcagcaactcccca |
33355664 |
T |
|
| Q |
260 |
acaaattaaactgatgaatccaaaagtgaatgaaatgttatcattaacattgcagagacagtc |
322 |
Q |
| |
|
| | |||||| |||| ||| ||| ||||||| |||| ||| | | |||||| |||||||| |
|
|
| T |
33355665 |
tgatactaaactcatgagtcccaaactgaatgatatgtcatctctcaaattgcaaagacagtc |
33355727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University