View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12590_low_28 (Length: 309)
Name: NF12590_low_28
Description: NF12590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12590_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 24949799 - 24949890
Alignment:
| Q |
19 |
tcatgtctctctttgttttctaatatagacaatagacatccctgagttatgtatgtatgtcaaaagagtaagtcaaaagatccgttgatata |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24949799 |
tcatgtctctctttgttttctaatatagacaatagacatcactgagctatgtacgtatgtcaaaagagtaagtcaaaagatccgttgatata |
24949890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 125 - 232
Target Start/End: Original strand, 24949733 - 24949841
Alignment:
| Q |
125 |
gtgacacaatgtagtcataactttgcataaaaacaaaattatgatataatttgttgaaatgaacggtgatgtctctctttgttttctga-ctagacaata |
223 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||||||||||| |||||||||| ||||||||| ||| ||||||||||||||||||| | ||||||||| |
|
|
| T |
24949733 |
gtgacacgatgtagccatgactttgcataaaaacaaaattgtgatataattgtctgaaatgaatggtcatgtctctctttgttttctaatatagacaata |
24949832 |
T |
 |
| Q |
224 |
gacatcact |
232 |
Q |
| |
|
||||||||| |
|
|
| T |
24949833 |
gacatcact |
24949841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University