View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12590_low_28 (Length: 309)

Name: NF12590_low_28
Description: NF12590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12590_low_28
NF12590_low_28
[»] chr8 (2 HSPs)
chr8 (19-110)||(24949799-24949890)
chr8 (125-232)||(24949733-24949841)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 24949799 - 24949890
Alignment:
19 tcatgtctctctttgttttctaatatagacaatagacatccctgagttatgtatgtatgtcaaaagagtaagtcaaaagatccgttgatata 110  Q
    |||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||    
24949799 tcatgtctctctttgttttctaatatagacaatagacatcactgagctatgtacgtatgtcaaaagagtaagtcaaaagatccgttgatata 24949890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 125 - 232
Target Start/End: Original strand, 24949733 - 24949841
Alignment:
125 gtgacacaatgtagtcataactttgcataaaaacaaaattatgatataatttgttgaaatgaacggtgatgtctctctttgttttctga-ctagacaata 223  Q
    ||||||| |||||| ||| ||||||||||||||||||||| ||||||||||   ||||||||| ||| ||||||||||||||||||| |  |||||||||    
24949733 gtgacacgatgtagccatgactttgcataaaaacaaaattgtgatataattgtctgaaatgaatggtcatgtctctctttgttttctaatatagacaata 24949832  T
224 gacatcact 232  Q
    |||||||||    
24949833 gacatcact 24949841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University