View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12590_low_30 (Length: 292)
Name: NF12590_low_30
Description: NF12590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12590_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 18 - 281
Target Start/End: Complemental strand, 43985819 - 43985556
Alignment:
| Q |
18 |
aacaaggtcaagcattttcaacagagcttgtttgattgaagttggaactgtgccaccactgttggatcttttagctacggaggataaaaccactcaggag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985819 |
aacaaggtcaagcattttcaacagagcttgtttgattgaagttggaactgtgccaccactgttggatcttttagctacggaggataaaaccactcaggag |
43985720 |
T |
 |
| Q |
118 |
aatgcaatctctgctttactgaagctttcaaagtatgcaaccgggcctgaaaatataatagaccataacggtttaaatcccgttgtgtatgtactgaaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43985719 |
aatgcaatctctgctttactgaagctttcaaagtatgcaaccgggcctgaaaatataatagaccataacggtttaaagcccgttgtgtatgtactgaaaa |
43985620 |
T |
 |
| Q |
218 |
atggacttagtcttgaagcccgtcaaattgtagctgctataatattctatctttgttcagtgaa |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
43985619 |
atggacttagtcttgaagcccgtcaaattgcagcagctataatattctatctttgttcagtgaa |
43985556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University