View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12590_low_33 (Length: 260)
Name: NF12590_low_33
Description: NF12590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12590_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 256
Target Start/End: Complemental strand, 4705918 - 4705678
Alignment:
| Q |
16 |
aatagcaaatcatgttcaaattctggtaaaatagttaggtattacaacttacaaggtagaaaggatatgcaagcattggaaaaggtattgtaaatctcaa |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4705918 |
aatagcaaaacatgttcaaattctggtaaaatagttaggtattacaacttacaaggtagaaaggatatgcaagcattggaaaaggtattgtaaatctcaa |
4705819 |
T |
 |
| Q |
116 |
catttttgttgaattgtccaagctcctgaagattttctctggcaactgcaagatttggaattaaatgtaatggattagaaactctgaattttgaaagaca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4705818 |
catttttgttgaattgtccaagctcctgaagattttctctggcaactgcaagatttggaattaaatgtaatggattagaaactctgaatttcgaaagaca |
4705719 |
T |
 |
| Q |
216 |
atgatgtcaatctcaaatagcagaaaatagaggttagttca |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4705718 |
atgatgtcaatctcaaatagcagaaaatagaggttagttca |
4705678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University