View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12590_low_34 (Length: 251)
Name: NF12590_low_34
Description: NF12590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12590_low_34 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 20 - 251
Target Start/End: Complemental strand, 48894810 - 48894579
Alignment:
| Q |
20 |
tcagcttgcagaaattgttgtgtcaacaacagtaaccacatgatgaagcttcgatttattgctgtggttgttatgctgttaagttgtacggagagacaca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48894810 |
tcagcttgcagaaattgttgtgtcaacaacagtaaccacatgatgaagcttcgatttatggctgtggttgttatgctgttaagttgtacggagagacaca |
48894711 |
T |
 |
| Q |
120 |
aatcaactgcaaagggttcagagaatgaatacacagtagaatcagtgagagcatctttaattagacaagaggatacaatcatatttagtgtgattgagag |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48894710 |
aatcaactgcaaagggttcagagaatgaatacacagttgaatcagtgagagcatctttaattagacaagaggatacaatcatatttagtgtgattgagag |
48894611 |
T |
 |
| Q |
220 |
agcaagattcccacttaattctcccacctacc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48894610 |
agcaagattcccacttaattctcccacctacc |
48894579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University