View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12590_low_42 (Length: 239)
Name: NF12590_low_42
Description: NF12590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12590_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 4847918 - 4848137
Alignment:
| Q |
1 |
ttgttatcaactaacttttcatacgactctatatatgccatgtatcaatgctgctaatcaatgagaatcacttttaccctacatcttctaactttttcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4847918 |
ttgttatcaactaacttttcatacgactctatatatgccatgtatcaatgctgctaatcaatgagaatcacttttaccctacatcttctaactttttcct |
4848017 |
T |
 |
| Q |
101 |
ttcccctctcatattcaaccactcaataatttttagatattnnnnnnngttgaaagtgcttaatgaatatgtcaatcaacaaaccaattgctgcacaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4848018 |
ttcccctctcatattcaaccactcaagaatttttagatattaaaaaaagtttaaagtgcttaatgaatatgtcaatcaacaaaccaattgctgcacaaat |
4848117 |
T |
 |
| Q |
201 |
cgagctggcataactcttca |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4848118 |
cgagctggcataactcttca |
4848137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 5187644 - 5187530
Alignment:
| Q |
1 |
ttgttatcaactaacttttcatacgactctatatatgccatgtatcaatgctgctaatcaatgagaatcacttttaccctacatcttctaactttttcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
5187644 |
ttgttatcaactaacttttcatacgactctatatatgccatgtatcaatgtagttaatcaatgagaatcagttttaccctacatcttctaaccttttcct |
5187545 |
T |
 |
| Q |
101 |
ttcccctctcatatt |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5187544 |
ttcccctctcatatt |
5187530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 156 - 220
Target Start/End: Original strand, 4851021 - 4851085
Alignment:
| Q |
156 |
gtgcttaatgaatatgtcaatcaacaaaccaattgctgcacaaatcgagctggcataactcttca |
220 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4851021 |
gtgcttaatgaaaatgtcaatcaacaaaccaattgctgcacaaatcgagctggcgtaactcttca |
4851085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 81 - 141
Target Start/End: Original strand, 4850865 - 4850925
Alignment:
| Q |
81 |
acatcttctaactttttcctttcccctctcatattcaaccactcaataatttttagatatt |
141 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4850865 |
acattttctaactttttcctttcccctctcatattcaaccactcaagaatttttagatatt |
4850925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University